To our knowledge, this is the first report that Leifsonia xyli subsp. xyli, previously named Clavibacter xyli subsp. xyli (2), has been detected and identified in sugarcane in Jamaica. Although ratoon stunting (also known as ratoon stunting disease or RSD) has been reported in Jamaica since 1961, presence of the pathogen had never been confirmed in symptomatic tissues. A major industry-wide survey conducted in 1987 using the fluorescent antibody staining technique failed to detect positives in any of the 61 fields sampled in Jamaica. A new survey was conducted in 2004 on eight estates and the Sugar Industry Research Institute (SIRI) in Jamaica. Six arbitrarily selected stalks were sampled from each of 64 fields representing 25 different sugarcane cultivars. A 1-cm diameter core was extracted from the center of the bottom part of the stalk and used to detect the pathogen by tissue blot immunoassay (TBIA) (3). L. xyli subsp. xyli was detected in 26 of 384 samples (7%). At least one positive sample was found in 10 fields and seven cultivars and in one case (sugarcane cv. D14146 at the St Thomas Sugar Estate), all six stalks sampled in a field were positive. The highest number of infected fields (6 of 10) occurred at Worthy Park where cane yield in 2004 was 86.54 tons per ha compared with an average of 68.04 tons per ha for major estates in Jamaica (1). This latter result would indicate that where good quality agronomic practices are maintained, the effect of ratoon stunting might not be substantial or that sugar-cane cultivars grown at this location were resistant to ratoon stunting. Pathogen identification was confirmed using nested polymerase chain reaction (PCR) with three samples from a TBIA-positive field of cv. D14146. Primary primers were RSD 33 (CTGGCACCCTGTGTTGTTTTC) and RSD 297 (TTCGGTTCTCATCTCAGCGTC) and secondary, nested primers were RST60 (TCAACGCAGAGATTGTCCAG) and RST59 (CGTCTTGAAGACACAGCGATGAG). The thermocycler parameters were denaturization at 94°C for